klikaj i czytaj online

00387 006941 19967581 na godz. na dobę w sumie
Sprawdziany. Biologia. Gimnazjum. Klasa III. Sukces w nauce - ebook/pdf
Sprawdziany. Biologia. Gimnazjum. Klasa III. Sukces w nauce - ebook/pdf
Autor: Liczba stron: 38
Wydawca: Literat Język publikacji: polski
ISBN: 978-83-7898-479-5 Data wydania:
Kategoria: ebooki >> naukowe i akademickie >> biologia
Porównaj ceny (książka, ebook, audiobook).

Tematycznie ułożone sprawdziany z biologii (z kartami odpowiedzi) dla klasy trzeciej gimnazjum: Podstawy genetyki, Genetyka człowieka, Zadania z genetyki, Podstawy ekologii, Problemy środowiska i ochrona przyrody, Ewolucja życia, Sprawdzian wiedzy biologicznej przed egzaminem. Zadania zawarte w tej książce są zgodne z nową podstawą programową Ministerstwa Edukacji Narodowej; nadają się do samodzielnej pracy ucznia; ułatwiają wiadomości przed pracą klasową; mogą być wykorzystywane podczas przygotowań do konkursu przedmiotowego; umożliwiają powtórzenie wiadomości przed egzaminem na koniec gimnazjum; są materiałami pomocniczymi dla nauczycieli i nadają się do kserowania; pomagają w praktycznym sprawdzeniu wiedzy przyrodniczej; ćwiczą umiejętności korzystania z takich źródeł informacji, jak teksty, tabele, diagramy, schematy oraz fotografie.

Znajdź podobne książki Ostatnio czytane w tej kategorii

Darmowy fragment publikacji:

I PODSTAWY GENETYKI Zadanie 1. Zaznacz X poprawną odpowiedź. Podstawą współczesnej nauki o dziedziczeniu były odkrycia: A. I. Pawłowa; B. G. Mendla; C. K. Darwina; D. L. Pasteura. Zadanie 2. Zaznacz X poprawne dokończenie zdania. Nauka o regułach i mechanizmach dziedziczenia to: A. cytologia; B. biochemia; C. fizjologia; D. genetyka. Zadanie 3. Na rysunku przedstawiono fragment nici DNA. Wskaż elementy opisane literami A-D. A. zasada azotowa; B. nukleotyd; C. deoksyryboza; D. reszta kwasu fosforowego. ................................. ............................................ P P P A T CG T A P P P Zadanie 4. Dokończ zdanie. ................................. ................................. Zasada, według której kolejność nukleotydów w jednej nici DNA determinuje kolejność nukleotydów w drugiej nici, nazywa się regułą .................................................................... . Zadanie 5. Porównaj budowę DNA i RNA. Uzupełnij tabelę. CECHA LICZBA NICI TWORZĄCYCH CZĄSTECZKĘ CUKIER WCHODZĄCY W SKŁAD NUKLEOTYDU ZASADY AZOTOWE W NUKLEOTYDACH RESZTA KWASU NIEORGANICZNEGO UMIEJSCOWIENIE W KOMÓRCE RNA DNA Zadanie 6. Dopasuj funkcję do odpowiedniego rodzaju RNA. Rodzaj RNA A. mRNA B. tRNA C. rRNA FUNKCJA 1. przenosi informację genetyczną z jądra do cytoplazmy ODPOWIEDŹ A. .............................. 2. jest składnikiem rybosomów 3. transportuje aminokwasy podczas syntezy białek B. .............................. C. ............................. Zadanie 7. Korzystając z zamieszczonej tabeli kodu genetycznego, przetłumacz sekwencję genu na kolejność aminokwasów w cząsteczce białka zapisanej w tym genie. Zastosuj trzyliterowe skróty nazw aminokwasów. U C A G UUU Phe UUC Phe UUA Leu UUG Leu CUU Leu CUC Leu CUA Leu CUG Leu AUU Ile AUC Ile AUA Ile AUG Met GUU Val GUC Val GUA Val GUG Val UCU Ser UCC Ser UCA Ser UCG Ser CCU Pro CCC Pro CCA Pro CCG Pro ACU Thr ACC Thr ACA Thr ACG Thr GCU Ala GCC Ala GCA Ala GCG Ala UAU Tyr UAC Tyr UAA Koniec UAG Koniec UGU Cys UGC Cys UGA Koniec UGG Trp CAU His CAC His CAA Gln CAG Gln AAU Asn AAC Asn AAA Lys AAG Lys GAU Asp GAC Asp GAA Glu GAG Glu CGU Arg CGC Arg CGA Arg CGG Arg AGU Ser AGC Ser AGA Arg AGG Arg GGU Gly GGC Gly GGA Gly GGG Gly U C A G Nić kodująca DNA AUGAGGGCCGUCAUUUUAACGUAUGACGAAUGCUAA Aminokwasy w białku .................................................................................................... Zadanie 8. Kod genetyczny posiada swoje stałe cechy. Dokończ zdania, wpisując je w puste miejsca. A. Trzy nukleotydy oznaczają jeden aminokwas. Kod genetyczny jest ........................................... . B. Dana trójka nukleotydów oznacza zawsze jeden konkretny aminokwas. Kod genetyczny jest ........................................... . C. Z tego samego kodu genetycznego korzystają wszystkie organizmy. Kod genetyczny jest .......................................... . Zadanie 9. Uporządkuj fazy realizacji informacji genetycznej. Wpisz w puste komórki odpowiednie cyfry od 1 do 5. FAZA Pojawienie się kodonu STOP na nici mRNA, odłączenie białka od rybosomu. tRNA przenosi odpowiednie aminokwasy, zgodnie z zapisem na mRNA. Przepisanie informacji genetycznej z DNA na mRNA. Rybosom przesuwa się wzdłuż nici mRNA, cząsteczka białka wydłuża się. mRNA przemieszcza się z jądra do cytoplazmy i łączy się z rybosomami. KOLEJNOŚĆ Zadanie 10. Uzupełnij schemat procesu odczytywania informacji genetycznej, skorzystaj z określeń w ramce. translacja, transkrypcja, mRNA DNA ......................... ......................... ......................... BIAŁKO Zadanie 11. Połącz podane określenia z odpowiadającymi im opisami. OKREŚLENIE 1. gen 2. materiał genetyczny 3. kod genetyczny 4. translacja 5. genotyp 6. fenotyp 7. kariotyp 8. genom 9. kodon OPIS A. nić kwasu rybonukleinowego B. sposób zapisu informacji o budowie jednego białka C. podstawowa jednostka dziedziczenia, zbudowana z odcinków DNA D. proces syntezy białka E. zespół cech danego osobnika F. zestaw chromosomów charakterystyczny dla danego organizmu (komórki) G. kolejne nukleotydy w DNA lub mRNA kodujące jeden aminokwas H. całość DNA zawartego w haploidalnym zestawie chromosomów danego organizmu I. zestaw chromosomów danego osobnika ODPOWIEDŹ 1. ................. 2. ................. 3. ................. 4. ................. 5. ................. 6. ................. 7. ................. 8. ................. 9. ................. Zadanie 12. Wskaż i podpisz elementy budowy chromosomu, wykorzystując informacje zawarte w ramce. ramię, centromer, chromatyda Zadanie 13. Wybierz prawdziwe informacje dotyczące chromosomów. A. są zbudowane z nici DNA; B. przenoszą informację genetyczną z pokolenia na pokolenie; C. w komórkach rozrodczych występuje podwójny zestaw chromosomów; D. prawidłowe są odpowiedzi A i B. Zadanie 14. Podpisz rysunki informacjami zawartymi w ramce. heterozygota, homozygota dominująca, homozygota recesywna A A a a A a A ................................ B ................................ C ................................ Zadanie 15. Podkreśl poprawne dokończenie zdania. A. Chromosomy homologiczne to chromosomy tworzące pary – jeden od ojca, drugi od matki / nieuporządkowane chromosomy w komórce somatycznej. B. Haploidalna liczba chromosomów to zestaw chromosomów w komórce somatycznej / to zestaw chromosomów w komórce rozrodczej. C. Cytokineza to podział cytoplazmy / odciąganie chromatyd do przeciwległych biegunów komórki. Zadanie 16. Ułóż we właściwej kolejności etapy przebiegu mitozy. ETAP POPRAWNA KOLEJNOŚĆ Powstanie chromosomów z chromatyny, zanik otoczki jądrowej. Chromatydy stają się chromosomami potomnymi i tworzą dwa odrębne jądra komórkowe. Odtwarza się otoczka jądrowa. Replikacja materiału genetycznego. Podział cytoplazmy i powstanie dwóch identycznych komórek o takim samym materiale genetycznym. Chromosomy układają się w płaszczyźnie równikowej komórki. Odciąganie chromatyd do przeciwległych biegunów komórki. Zadanie 17. W tabeli zestawiono część informacji na temat dwóch typów podziałów zachodzących w komórkach – mitozy i mejozy. Uzupełnij brakujące informacje. Typ podziału Miejsce podziału Liczba chromosomów w komórkach potomnych Informacja genetyczna 1) ………………… 2) …………………. taka sama identyczna 3) ………………… komórki, z których powstaną gamety 4) …………………. zmieniona
Pobierz darmowy fragment (pdf)

Gdzie kupić całą publikację:

Sprawdziany. Biologia. Gimnazjum. Klasa III. Sukces w nauce

Opinie na temat publikacji:

Inne popularne pozycje z tej kategorii:

Czytaj również:

Prowadzisz stronę lub blog? Wstaw link do fragmentu tej książki i współpracuj z Cyfroteką: